RegulonDB RegulonDB 10.10: Gene Sequence
pepE gene sequence


Size: 690        A: 148  T: 167  G: 196  C: 179

Fasta

 

>pepE E. coli K12. Version NC_000913.3 GI:556503834
atggaactgcttttattgagtaactcgacgctgccgggtaaagcctggctggaacatgca
ctgccgctaattgctgaacagttgcagggtcgccgctcagcggtgtttatccctttcgct
ggcgtaacgcagacctgggatgattacacagcgaaaacggctgcggttctcgctccgctg
ggtgtttctgtcaccggtattcatagcgttgtcgatcccgttgccgcgattgaaaatgct
gagatcgtgattgtcggcggcgggaatactttccagttgctgaaacagtgccgcgagcgc
gggctgctggcaccaattactgacgtggttaaacgtggcgctctgtatattggctggagc
gcaggcgctaaccttgcttgcccaactattcgtaccaccaacgatatgccgattgtcgat
ccgcaaggtttcgatgcgctaaatctgttcccgctgcaaatcaacccgcacttcaccaac
gcgctgccggaaggccataaaggtgaaacccgtgagcagcgtattcgcgaactgctggtc
gtcgcgccagaactgacgattattggtctaccggaaggtaactggatcacagtgagtaaa
ggtcacgctacgctgggtggcccgaacaccacttatgtgtttaaggctggtgaagaagcg
gttccgctggaagctggtcaccgtttttaa
              
                            

Download fasta file
RegulonDB