RegulonDB RegulonDB 11.0: Gene Sequence
yjbE gene sequence


Size: 243        A: 47  T: 49  G: 79  C: 68

Fasta

 

>yjbE E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaagttctgtatggcatttttgccatatctgcgcttgcggcgacttctgcgtgg
gctgcacctgtacaggtgggcgaagcggcagggtcggcagcaacgtcggtttcggcgggg
agttcctccgcgaccagcgtcagcaccgtaagctcggcggtgggtgtcgcgcttgcggca
accggtggcggtgatggttctaataccgggaccaccacaaccacgaccaccagtacccag
taa
              
                            

Download fasta file
RegulonDB