RegulonDB RegulonDB 11.0: Gene Sequence
yjbF gene sequence


Size: 639        A: 160  T: 129  G: 173  C: 177

Fasta

 

>yjbF E. coli K12. Version NC_000913.3 GI:556503834
gtgaagcgacctgcactcattcttatctgcctgttattacaggcctgttcagccacgact
aaagagctgggcaattcactgtgggacagtctgttcggcacgccaggcgtacagctgacg
gatgatgatattcaaaatatgccctacgccagccagtacatgcagcttaatggcgggccg
cagttatttgtggtgctggccttcgctgaagacggacaacaaaaatgggtcactcaggat
caggctactctcgttacccaacatggccgtctggtgaagactctgctcggcggcgacaac
ctgattgaagtgaataaccttgctgccgacccgctgattaaacccgcacaaatcgttgat
ggcgcaagctggacgcgcacgatgggctggaccgagtaccagcaggtacgctacgccacc
gcacgctcagtcttcaaatgggatggcaccgataccgtcaaagtcggcagcgatgaaacc
ccggttcgcgtgctggacgaagaagtctccaccgaccaggcgcgctggcataaccgctat
tggatcgacagcgaagggcaaattcgccagtcggaacagtatctcggcgcggattatttt
ccggtgaaaaccactctcatcaaggcggcaaaacaatga
              
                            

Download fasta file
RegulonDB