RegulonDB RegulonDB 10.9: Gene Sequence
yjbQ gene sequence


Size: 417        A: 103  T: 98  G: 104  C: 112

Fasta

 

>yjbQ E. coli K12. Version NC_000913.3 GI:556503834
atgtggtatcaaaagacgctcacgcttagcgccaaatctcgtgggtttcatctggtaacg
gatgaaattctgaatcagctggctgatatgccgcgcgttaacatcggcttactgcatctg
ttgctgcaacatacctccgcctctctgacacttaatgagaactgcgatcccaccgtacgc
cacgacatggagcgttttttcctccgcaccgttcccgacaacggaaattatgagcatgac
tatgagggagcagacgatatgccttctcatatcaaatcctcaatgctgggaacatcgctt
gtattgccggtgcataaagggcgtattcagaccggcacctggcaaggcatttggctgggg
gaacatcgcatccacggcggatcgcgtcgcatcatcgcgacactacaaggggagtaa
              
                            

Download fasta file
RegulonDB