RegulonDB RegulonDB 10.8: Gene Sequence
actP gene sequence


Size: 1650        A: 296  T: 434  G: 482  C: 438

Fasta

 

>actP E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagagttctgacggcgcttgccgccacactccctttcgcagctaacgccgcggat
gctattagcggggccgtagagcgccagccaacgaactggcaggcgattattatgttcctg
attttcgtcgtgtttacgctcggcattacctactgggcatcaaaacgcgtacgttctcgt
agcgactactacaccgcaggcggcaatatcactggcttccagaacgggctggcgattgcc
ggggactatatgtccgccgcctcattcttggggatctccgcgctggtgtttacctccggc
tatgacggcttaatttactcgctgggcttcctggtgggctggccgatcattttgttcctg
attgccgaacgtctgcgtaacctggggcgctacacctttgccgatgtggcctcttaccgt
ctgaaacaagggccgattcgtattctttcggcctgtggttctctggtggtggtggcgctt
taccttatcgcccagatggtgggcgcaggtaaactgatcgagctgctgtttggccttaac
tatcacattgcggtggtgctggtcggcgtgctgatgatgatgtacgtcctgttcggcggc
atgctggcgaccacctgggtgcaaattatcaaagccgtgctgttgctgttcggtgccagc
tttatggcctttatggtgatgaaacacgtcggctttagcttcaacaatctgttcagtgaa
gcgatggcggtacacccgaaaggtgtcgacatcatgaagccgggcgggctggtgaaagat
ccgatctccgcgctctctctgggtctgggactgatgtttggtacggcgggcttgccgcac
attctgatgcgcttctttacagtcagcgatgcccgcgaagcacgtaagagcgtgttctac
gccaccgggtttatgggctacttctatattctgacctttattatcggcttcggcgcgatc
atgctggttggtgcgaatccggaatataaagacgcggcgggccatctgattggtggtaac
aacatggcggccgttcacctggcgaatgcagtgggcggcaacctgttcctcggttttatt
tcagcggttgctttcgccactatcctcgcggtggttgcgggtctgacgctggcgggcgca
tccgcggtttcgcatgacttgtacgctaacgtcttcaaaaaaggcgcgaccgaacgtgaa
gagctgcgggtatcaaaaatcaccgtactgatcctcggcgtgattgcgattatcctcggc
gtgctgtttgagaatcagaacatcgcctttatggtggggctggcgtttgccatcgcggcg
agctgtaacttcccgatcattctgctttctatgtactggtcgaaactgaccacgcgtggc
gcgatgatgggtggctggctggggctgattaccgcagtagtactgatgatcctcggcccg
acgatttgggtacagatccttggtcacgaaaaagccatcttcccgtatgaatacccggcg
ctgttctctatcaccgtggcattcctcggcatctggttcttctcggcaaccgataactca
gcggaaggcgcgcgtgagcgtgaactgttccgcgcgcagtttatccgctcccagaccggc
tttggcgttgagcaaggccgcgcgcattaa
              
                            

Download fasta file
RegulonDB