RegulonDB RegulonDB 10.9: Gene Sequence
nrfC gene sequence


Size: 672        A: 129  T: 154  G: 205  C: 184

Fasta

 

>nrfC E. coli K12. Version NC_000913.3 GI:556503834
atgacctggtctcgtcgccagtttctcaccggcgtcggcgtgctggcagccgtcagcggc
accgcagggcgcgtggtggcgaaaacgttgaatatcaatggggtgcgttacggcatggtg
catgacgagtcgttatgcatcggctgtaccgcctgtatggatgcttgtcgggaagtgaac
aaggtgccggaaggcgtctcgcgcctgacgattattcgtagcgagccgcagggcgaattt
cctgatgtgaaatatcgcttcttccgtaagtcttgccagcactgcgatcatgcgccgtgc
gttgacgtctgcccgaccggtgcgtcttttcgcgatgctgccagtgggattgtcgatgtt
aatccggatctctgcgtcggttgtcagtactgcatcgccgcctgtccgtaccgcgtgcgc
tttatccatccggtcacgaagacggcggacaaatgcgatttctgccgtaagaccaatttg
caggccggtaagttgcccgcgtgcgttgaagcttgcccgaccaaggcgctgacgtttggc
aatctggacgatcccaacagtgagatttcgcaactgctgcgccagaagcccacttaccgc
tacaagctggcgctgggaaccaaaccgaagctgtaccgcgtaccgtttaaatacggggag
gtgagccaatga
              
                            

Download fasta file
RegulonDB