RegulonDB RegulonDB 10.8: Gene Sequence
nrfD gene sequence


Size: 957        A: 137  T: 269  G: 309  C: 242

Fasta

 

>nrfD E. coli K12. Version NC_000913.3 GI:556503834
atgacgcagacttccgcatttcattttgaatcgctggtgtgggactggccgattgccatc
tacctgtttttgattggtatttctgctggtctggtgacgctggccgtgctgttacgtcgc
ttctacccgcaggcgggcggtgcagacagtacgttgctgcgcaccacgctgattgtcggg
ccgggcgcggtgatcctcggtctgttgatcctcgtcttccacctgacaagaccgtggacc
ttctggaagctgatgttccactacagttttacctcggtgatgtcgatgggggtgatgctg
tttcagctctacatggtggtgctggtgctgtggctggcgaaaatctttgaacatgatttg
cttgccctgcaacaacgctggttgccgaagctggggatcgtgcaaaaggttctgagcctg
ctgacgcccgttcatcgcggactggaaacattgatgctggtgctggcggtgttgttgggg
gcttataccggctttctgctgtcggcgctgaaatcgtatccgttcctcaataacccgatc
ctgccggtgctgttcctcttctccggcatctcgtccggtgcggcggtggcgctgatcgcc
atggcgatacgccaacgcagtaacccgcattccacggaagcgcagtttgtacaccgtatg
gaaatccctgtggtatggggtgaaatcttcctgctggtggcgttttttgtcggtctggcg
ctgggcgatgacggtaaagttcgtgcgctggtggcggcattaggtggcggtttctggacg
tggtggttctggcttggtgtcgccgggctggggctgattgtgccaatgctgctcaaaccg
tgggtcaatcgcagttccggcattcctgccgtgctggcggcgtgtggggccagtctggtc
ggcgtgttgatgctgcgctttttcattctctacgccggacagttgacggtggcgtaa
              
                            

Download fasta file
RegulonDB