RegulonDB RegulonDB 10.9: Gene Sequence
nrfF gene sequence


Size: 384        A: 92  T: 91  G: 109  C: 92

Fasta

 

>nrfF E. coli K12. Version NC_000913.3 GI:556503834
atgaataaagggcttctcacgctactgctgttatttacctgttttgcgcacgctcaggtc
gtagacacctggcaattcgccaatccgcaacaacagcaacaggcgttaaatattgccagc
cagttacgttgtccgcagtgccagaatcaaaacttactggaatccaacgcgccggtggct
gtcagtatgcgccatcaggtttacagcatggtggcggaggggaagaacgaagtcgaaatc
attggctggatgaccgaacgctacggagattttgttcgctataacccaccgttaacgggt
cagacgctggtgttatgggcgctgccagtggtgttgttactgctgatggcactgatcctc
tggcgagtgagggcgaagcgatga
              
                            

Download fasta file
RegulonDB