RegulonDB RegulonDB 10.9: Gene Sequence
flgK gene sequence


Size: 1644        A: 434  T: 358  G: 448  C: 404

Fasta

 

>flgK E. coli K12. Version NC_000913.3 GI:556503834
atgtccagcttgattaataacgccatgagcggactgaacgcggcccaggcggcgttaaat
acggcaagtaataatatctccagctataacgttgccggatatacccgccaaaccactatt
atggcgcaggccaatagcacgttgggcgctggcggctgggttggcaatggtgtctacgtt
tctggtgtgcagcgtgagtatgatgcgtttattaccaaccagttacgtgcggcgcagacg
caaagtagcggtctgactgcccgctatgagcagatgtcgaaaatcgacaatatgctctcc
accagtacctcttcgctggcaacacagatgcaggatttcttcaccagcctgcaaacgctg
gtgagtaacgcggaagacccggcagcgcgccaggcgctgattgggaaatcagaaggattg
gtgaatcagtttaaaaccaccgatcaatatctgcgcgaccaggacaaacaggtcaatatc
gcgataggtgccagcgttgatcagatcaacaactacgctaaacaaattgccagcctgaac
gatcaaatctcgcgcctgacaggcgtgggggcaggggcgtcacctaacaatctgctggat
caacgcgatcaactggtgagcgaattaaaccagattgttggtgtagaagtcagcgttcag
gatggcggcacttataacatcacgatggccaatggttactcactggttcagggaagtacg
gcgcggcaactggcggcagttccttccagcgctgacccttctcgtacgactgtcgcttat
gttgatgggacggcaggcaatattgagatcccggagaaattactgaataccgggtcgctg
ggcggcattctgacattccgttctcaggatctggaccagacgcgtaatacgcttggacaa
ctggcgctggcatttgccgaggctttcaacacccaacacaaagccggatttgatgctaac
ggcgatgccggtgaagatttctttgctatcggtaagcccgcggttctgcaaaacacgaaa
aacaaaggtgacgttgcgatcggtgccacggtaactgatgcctccgcggtactggcgaca
gattacaaaatctcgttcgataataatcagtggcaggtcacccgccttgccagcaatacc
acttttacggtgacgccggatgccaacggtaaagtggcatttgatggtctggagttgacg
tttacaggaacgcctgccgttaacgacagcttcacgctgaaaccagtaagtgacgccatc
gtcaacatggatgtattaatcaccgacgaagcgaaaatagcgatggcgagcgaagaagat
gcgggtgatagcgataaccgcaacggtcaggccctgctggatctgcaaagcaacagtaaa
acggtgggcggtgcgaaatcctttaacgacgcttatgcctcgttagtgagtgatatcggt
aataaaaccgcgacgttgaaaaccagtagcgccacgcaaggtaatgtggtgacgcagctt
tccaatcagcagcagtcgatttccggtgtcaatctcgatgaggagtacggaaatctgcaa
cgttttcagcagtattacctggcgaatgcgcaggttctgcagacggcaaacgcgattttt
gatgcgctgattaacattcgctaa
              
                            

Download fasta file
RegulonDB