RegulonDB RegulonDB 10.9: Gene Sequence
htrE gene sequence


Size: 2598        A: 744  T: 728  G: 581  C: 545

Fasta

 

>htrE E. coli K12. Version NC_000913.3 GI:556503834
gtgactatagaatatactaaaaattatcatcatctgacccgtatcgccacgttttgcgcg
ctgctgtattgcaatactgctttcagtgctgaactcgttgaatatgaccataccttcctg
atggggcagaatgcatctaatattgatctcagccggtacagtgaaggtaaccccgctata
ccgggtgtttacgacgtcagtgtttatgtaaacgaccaaccaatcattaaccaaagtatt
acatttgtcgcaattgaaggaaaaaagaacgcccaggcttgtatcacattaaagaattta
ttgcagtttcatattaattctcccgatataaataacgaaaaagccgttctgcttgccagg
gatgaaacgctcggcaattgcctcaatttgacggaaattatccctcaggcttctgttcgt
tatgacgttaacgatcaacgtctggatatagacgttcctcaagcctgggtaatgaaaaat
taccaaaactatgttgatccatcgttatgggaaaacggcattaatgcggccatgttgtca
tacaacctcaacggatatcatagtgaaacccctggtcgaaaaaatgaaagcatttatgct
gcatttaacggtgggatgaatttaggtgcatggcgactgcgtgcctcgggcaactacaac
tggatgaccgattctggcagtaattatgattttaagaatcggtatgttcagcgtgatatc
gcctcgctgcgttctcaactcattcttggtgagtcttatacgacgggcgaaacctttgat
tccgtcagtatccgaggcattcgtttatacagtgacagccgcatgttgcctccgacttta
gccagctttgcgcctatcattcatggcgttgccaataccaacgccaaagtcactattacg
caaggtggctataagatttatgaaacgacggtgccgccaggcgctttcgtcattgatgat
ctgagtccgtcagggtacggcagcgatcttattgttaccatcgaagaatccgatggctca
aagcggacattctcgcaacctttctcatccgttgttcaaatgttacgccctggcgttgga
cgttgggatattagcggcggtcaggtcttaaaagatgatattcaggatgagcctaattta
tttcaagcaagctactactacggcctgaataactatctgacgggttataccggtattcag
ataaccgataataactataccgctggtttgttaggtcttggtctgaatacttcagttggt
gcattttctttcgatgtgactcattccaatgttcgtatcccggatgataaaacataccag
gggcaaagttatcgtgtttcctggaacaagttattcgaagaaacaagtacttcactgaat
atcgcggcctatcgctattcgacacagaattaccttggtcttaatgatgcactaactcta
attgatgaagtgaaacatcccgaacaagatcttgaaccgaaatccatgcgtaattactca
cgcatgaaaaatcaggttacggtcagtattaaccaaccgttgaaatttgagaaaaaagat
tacggttcattttatctttccggaagttggtccgattactgggcttccggacaaaatcgt
agcaattactctattggctacagtaacagtacatcctggggcagctacagtgtcagtgcc
cagcgttcatggaatgaagacggcgacactgacgatagcgtttatcttagtttcaccatt
ccaattgaaaaattacttggcactgaacaacgtacttcaggtttccagagtattgatact
caaataagcagtgactttaagggtaataaccaactcaacgttagcagcagtggctatagc
gataacgctcgcgtcagttatagcgtgaatactggctatacgatgaataaagccagcaaa
gatttgagttatgttgggggttatgccagctatgagtcaccatggggaacgctggcaggt
tcaatttctgcaaatagcgataacagccgtcaagtttctctcagcaccgacggtggtttt
gtattgcatagcggtggactgactttcagtaatgatagttttagcgactccgatacactg
gcggtagttcaggctccaggtgctcaaggagcgcgaataaattatggcaacagtactatc
gatcgatggggttatggtgtcaccagcgctctttctccttatcatgaaaaccgtatcgcg
ctggatatcaacgatcttgagaacgatgttgaattaaaaagtaccagtgcagtagctgta
ccgcgtcagggttcagtcgtctttgctgattttgaaaccgtgcaagggcaatcagccatt
atgaacatcacacgaagtgatggtaaaaatattccatttgctgcagatatttatgatgag
caaggcaatgtcattggtaatgttggacagggtggacaagcatttgttcgtggtattgag
cagcagggaaatatcagcattaaatggctcgaacaaagtaaacccgtaagttgtcttgcg
cattatcaacaaagcccagaagcagaaaaaatagcacaatctattattctgaatggaatt
cggtgtcagattcagtaa
              
                            

Download fasta file
RegulonDB