RegulonDB RegulonDB 10.9: Gene Sequence
yadV gene sequence


Size: 741        A: 215  T: 197  G: 169  C: 160

Fasta

 

>yadV E. coli K12. Version NC_000913.3 GI:556503834
atgttttttaacaccaaacatacaacagctttatgcttcgtaacctgtatggcttttagt
tcatcgtctattgcggacattgtcatttcgggtactcgcgtaatatataaaagcgatcaa
aaaagtgtcaacgtacgtctggaaaataaagggaataacccgttgcttgtccagagttgg
ttagatactggcgatgacaacgctgagcctggcagtattacagtcccttttactgctacg
ccgccagtatcgcgtattgatgccaaacgtgggcaaacaatcaaattaatgtacacagcc
agcacctcactgcctaaagacagagagagcgtgttctggtttaacgtactggaagttcca
ccaaaaccagatgcagaaaaggtcgcgaatcaaagcctgctgcaactggcatttcgcaca
cgtataaaacttttctatcgcccggatggattgaagggaaatccctctgaagccccgtta
gccctgaagtggttctggtcaggttcagaaggtaaggcgtcattacgagtgaccaatcca
accccttactacgtctcttttagcagtggtgatttagaagctagcggtaaacgctatccg
attgatgtgaaaatgattgcaccatttagtgatgaggtcatgaaagtcaatggccttaat
ggcaaagcgaattctgcaaaagtgcatttttacgccattaatgactttggtggcgcaatt
gaaggtaatgccaggctgtaa
              
                            

Download fasta file
RegulonDB