RegulonDB RegulonDB 10.9: Gene Sequence
fliP gene sequence


Size: 738        A: 140  T: 206  G: 200  C: 192

Fasta

 

>fliP E. coli K12. Version NC_000913.3 GI:556503834
atgcgtcgtttattgtctgtcgcacctgtccttctctggctgattacgcccctcgccttc
gcgcaactgccgggtatcaccagccagccgctgcctggcggtggacaaagctggtcgctc
ccggtgcagacgctggtgttcatcacctcgttgacgtttattccggcaattttactgatg
atgaccagtttcacccgcatcatcattgtttttggtttattgcgtaacgcgctgggaaca
ccctccgcgccacctaaccaggtattgctggggctggcactgtttttgaccttttttatt
atgtcaccggtgatcgacaaaatttatgtagatgcgtaccagccattcagcgaagagaaa
atatcaatgcaggaggcgctggaaaaaggggcgcagccgctgcgtgagtttatgctgcgt
cagacccgtgaggcagatttagggttgtttgccagactggcgaataccggcccgttgcag
ggacctgaagccgtgccgatgcgcattttgctcccggcctacgtgaccagcgagttgaaa
accgcatttcagataggcttcacgattttcatcccttttttgattatcgacctggtgata
gccagcgtgttgatggcattggggatgatgatggttcccccagccaccattgctctgccc
tttaaactgatgctgtttgtactggtggatggctggcaattgctggtcggttcgctggcg
cagagcttttacagctag
              
                            

Download fasta file
RegulonDB