RegulonDB RegulonDB 11.0: Gene Sequence
fliR gene sequence


Size: 786        A: 159  T: 254  G: 184  C: 189

Fasta

 

>fliR E. coli K12. Version NC_000913.3 GI:556503834
atgttgcaggtgacaagcgaacaatggctatcctggttaaacctgtacttctggccgtta
ctgcgcgtgctggcgctgatctccaccgcgccgattctgagcgaacgcagcgtaccgaaa
cgggtaaaactgggtctggcaatgatgatcacgttcgccattgccccatcattacctgcc
aacgatgttcctgttttttcgttctttgctctgtggctggccgtgcagcagatcctgatc
ggcattgcgcttggttttaccatgcaatttgcctttgccgctgtgcgaaccgctggcgaa
attatcggtctgcaaatggggctgtcatttgcgacgtttgtcgatccggccagccatctt
aatatgcccgttttagcgcgtatcatggatatgctggcgttactgctgttcctgacattt
aacggtcatttatggttgatttcactgctggtcgatacctttcacaccctgccgattggt
ggcgaaccgttgaacagcaatgcgtttctggcactcaccaaagcagggagtttgattttc
cttaacgggctgatgctggcgttaccgctcattactctgctgctgacactgaatctggca
ttaggtttacttaatcgtatggccccgcaattatccatttttgttattggatttccatta
actctgactgtcggcatctctttaatggcggcattaatgccgttaattgcacctttttgc
gaacatttattcagtgaaatttttaatttgctggctgatattattagtgaattgccatta
atataa
              
                            

Download fasta file
RegulonDB