RegulonDB RegulonDB 10.9: Gene Sequence
rfbC gene sequence


Size: 558        A: 163  T: 179  G: 120  C: 96

Fasta

 

>rfbC E. coli K12. Version NC_000913.3 GI:556503834
atgaatgtgattagaactgaaattgaagatgtgctaattctggagccaagagtatttggt
gatgatagaggtttcttttatgagagctttaatcaatcagcatttgaacatattctaggc
tatccggtcagctttgttcaagacaatcactcacgttcatcaaaaaatgtactcagaggc
cttcactttcaacgcggcgagtacgcacaagataaacttgtacgctgcactcatggagca
gtttttgatgttgctgttgatattcgacccaattcggtatcctttggtaaatgggttggt
gttctgctttcagctgataataagcagcagttgtggataccaaaagggtttgctcatggc
tttttggttctgtctgatatcgctgaatttcaatataaaactacaaactattatcatcct
gaaagcgattgtggaatatgttggaatgatgaacgcattgcaattgattggccccaaaca
tcagggttaatcctttcgccaaaagatgaaaggctctttacgttagatgagcttatcaga
ttaaaattaattgcatga
              
                            

Download fasta file
RegulonDB