RegulonDB RegulonDB 10.9: Gene Sequence
glf gene sequence


Size: 1104        A: 383  T: 328  G: 234  C: 159

Fasta

 

>glf E. coli K12. Version NC_000913.3 GI:556503834
atgtacgattatatcattgttggttctggtttgtttggtgccgtttgtgcgaatgagtta
aaaaagctaaacaaaaaagttttagtgattgagaaaagaaatcatatcggtggaaatgcg
tacacagaggactgtgagggtatccagattcataaatatggtgcacatatttttcatacc
aatgataaatatatatgggattacgttaatgatttagtagaatttaatcgttttactaat
tctccactggcgatttataaagacaaattattcaaccttccttttaatatgaatactttc
caccaaatgtggggagttaaagatcctcaagaagctcaaaatatcattaatgctcagaaa
aaaaagtatggtgacaaggtacctgaaaatttggaggagcaggcgatttcattagttggg
gaggacttataccaagcattgataaagggttatacggagaagcagtggggaagaagtgca
aaagaattgcctgcatttattattaagcgaatcccagtgagatttacgtttgataacaat
tatttttccgatcgctatcaaggtattccggtgggaggctacactaagcttattgaaaaa
atgcttgaaggtgtggacgtaaaattaggcattgattttttgaaagacaaagattctcta
gcgagtaaagcccatagaatcatctacactggacccattgatcagtacttcgactatagg
tttggagcgttagaatatcgctctttaaaatttgagacggaacgccatgaatttccaaac
ttccaagggaatgcagtaataaatttcactgatgctaatgtaccatataccagaataatt
gagcataaacattttgactatgttgagacaaagcatacggttgttacaaaagaatatcca
ttagagtggaaagttggcgacgaaccctactatccagttaatgataataaaaacatggag
ctttttaagaaatatagagagttagctagcagagaagacaaggttatatttggcgggcgt
ttggccgagtataaatattatgatatgcatcaagtgatatctgccgctctttatcaagtg
aaaaatataatgagtacggattaa
              
                            

Download fasta file
RegulonDB