RegulonDB RegulonDB 10.9: Gene Sequence
wbbH gene sequence


Size: 1167        A: 324  T: 466  G: 204  C: 173

Fasta

 

>wbbH E. coli K12. Version NC_000913.3 GI:556503834
atgatctatcttgtaattagtgtctttctcattacagcatttatctgtttatatcttaag
aaggatatattttatccagccgtatgcgttaatatcatcttcgcactggtcttattggga
tatgaaataacgtcagatatatatgcttttcagttaaatgacgctacgttgatttttcta
ctttgcaatgttttgacatttaccctgtcatgtttattgacggaaagtgtattagatcta
aatatcagaaaagtcaataatgctatttatagcataccatcgaagaaagtgcataatgta
ggcttgttagttatttctttttcgatgatatatatatgcatgaggttaagtaactaccag
ttcgggactagcttacttagctatatgaatttgataagagatgctgatgttgaagacaca
tcaagaaatttctcagcatacatgcagccaatcattctaactacttttgctttatttatt
tggtctaaaaaatttactaatacaaaggtaagtaaaacatttactttacttgtttttatt
gtattcatctttgcaattatactgaatactggtaagcaaattgtctttatggttatcatc
tcttatgcattcatcgtaggtgttaatagagtaaaacattatgtttatcttattacagct
gtaggtgttctattctccttgtatatgctctttttacgtggactgcctggggggatggca
tattatctatccatgtatttggtcagccctataatcgcgtttcaggagttttattttcag
caagtatctaactctgccagttctcatgtcttttggttttttgaaaggctgatggggcta
ttaacaggtggagtctctatgtcgttgcataaagaatttgtgtgggtgggtttgccaaca
aatgtttatactgctttttcggattatgtttatatttccgcggagctaagctatttgatg
atggttattcatggctgtatttcaggtgttttatggagattgtctcgaaattacatatct
gtgaaaatattttattcatattttatttataccttttctttcattttttatcatgaaagc
ttcatgactaatattagcagttggatacaaataactctttgtatcatagtattctctcaa
tttcttaaggcccagaaaataaagtga
              
                            

Download fasta file
RegulonDB