RegulonDB RegulonDB 10.9: Gene Sequence
wbbI gene sequence


Size: 993        A: 316  T: 320  G: 197  C: 160

Fasta

 

>wbbI E. coli K12. Version NC_000913.3 GI:556503834
atgtattttttgaatgatttaaatttctctagacgcgatgctggatttaaagcaagaaaa
gatgcactggacattgcttcagattatgaaaacatttctgttgttaacattcctctatgg
ggtggagtagtccagagaattattagttctgttaagcttagtacatttctctgcggtctt
gaaaataaagatgttttaattttcaatttcccgatggccaaaccattttggcatatattg
tcattctttcaccgccttctaaaatttagaatagtacctctgattcatgatattgatgaa
ttaagaggaggagggggtagtgattctgtgcggcttgctacctgtgatatggtcataagt
cacaatccacaaatgacaaagtaccttagtaaatatatgtctcaggataaaatcaaagac
ataaaaatatttgattacctcgtctcatctgatgtggagcatcgagatgttacggataag
caacgaggggtcatatatgctggcaacctttctaggcataaatgttctttcatatatact
gaaggatgcgattttactctctttggtgtcaactatgaaaataaagataatcctaaatat
cttggaagttttgatgctcaatctccggaaaagattaacctcccaggcatgcaatttgga
ctcatttgggatggagattctgtcgaaacctgtagtggtgcctttggcgactatttaaag
tttaataaccctcataagacatctctttatctttcaatggaacttccagtatttatatgg
gataaagccgcccttgcggatttcattgtagataatagaataggatatgcagtgggatca
atcaaagaaatgcaagagattgttgactccatgacaatagaaacttataagcaaattagt
gagaatacaaaaattatttctcagaaaattcgaacaggaagttacttcagggatgttctt
gaagaggtgatcgatgatcttaaaactcgctaa
              
                            

Download fasta file
RegulonDB