RegulonDB RegulonDB 10.9: Gene Sequence
wbbJ gene sequence


Size: 591        A: 161  T: 190  G: 138  C: 102

Fasta

 

>wbbJ E. coli K12. Version NC_000913.3 GI:556503834
atgatcttaaaactcgctaaacgatatggtctctgtggttttattcggcttgttagagat
gtcttattgactcgtgtattttaccggaactgtagaattattcgatttccctgctatatt
cgcaatgatggtagcattaattttggtgaaaatttcacaagtggagtcggtctcaggctg
gatgcatttggacgtggcgtgatttttttttccgataatgtgcaagttaacgactatgtt
catatcgcctcaattgagagcgttacgataggtcgggatacgcttattgcaagtaaagta
tttattaccgatcataatcacggttcctttaagcactctgatccaatgagttcgccaaat
atacctccagacatgcgcacgttggaatcttcagctgttgtaattggccagagggtttgg
ttgggtgagaatgtgacggttttgcctggaacaattattggtaatggagtcgtagtcggc
gccaattctgttgttagaggttctattcccgaaaatactgtcattgcgggagtaccagca
aaaatcataaagaaatacaatcatgagaccaaattatgggaaaaagcatag
              
                            

Download fasta file
RegulonDB