RegulonDB RegulonDB 10.10: Gene Sequence
wbbK gene sequence


Size: 1119        A: 386  T: 376  G: 198  C: 159

Fasta

 

>wbbK E. coli K12. Version NC_000913.3 GI:556503834
atgggaaaaagcatagtcgttgtttctgcggtcaattttaccactggcggtccatttacc
attttgaaaaaatttttggcagcaactaataataaagaaaatgtcagttttatcgcatta
gtccattctgctaaagagttaaaagaaagttatccatgggttaaattcattgagtttcct
gaggttaaagggtcgtggctaaaacgtttgcactttgaatatgtagtttgtaaaaaactt
tcaaaagagctgaatgctacgcattggatttgtctgcatgatattacggccaatgtcgtc
actaaaaaaagatatgtgtattgtcataaccctgcacctttttataaaggaattttattc
cgtgaaattcttatggagcctagctttttcttatttaaaatgctatacgggctgatatat
aaaataaacattaaaaaaaatactgcagtgtttgttcaacaattctggatgaaagaaaaa
tttatcaagaaatattctataaataacatcattgtcagtcggccagaaattaaattatct
gataaaagccaacttactgatgatgattctcaatttaagaataacccttctgagttgaca
atattttaccctgctgttccacgagtatttaaaaattacgagcttattattagtgcagca
aggaaattgaaagaacaatccaatattaaatttctgcttactatcagtggtacagaaaat
gcgtatgcaaaatatattatcagtcttgcagaaggactggataatgttcatttcctcggg
tacttggataaagaaaaaatcgatcattgttataatatttcagatatagtttgttttccc
tctaggttagaaacatggggattgccgttgtctgaagctaaagagcgaggtaagtgggta
ttagcatcagatttcccatttactagagaaactcttggtagttatgaaaagaaagctttt
tttgattctaataacgatgacatgttagttaaacttattattgacttcaaaaaaggtaac
ctcaaaaaagatatctctgatgcaaatttcatttatcgtaatgaaaatgtattagttggg
tttgatgaactagttaattttattactgaagaacattga
              
                            

Download fasta file
RegulonDB