RegulonDB RegulonDB 10.9: Gene Sequence
wbbL gene sequence


Size: 795        A: 242  T: 272  G: 151  C: 130

Fasta

 

>wbbL E. coli K12. Version NC_000913.3 GI:556503834
atggtatatataataatcgtttcccacggacatgaagactacatcaaaaaattactcgaa
aatcttaatgctgacgatgagcactacaagattatcgtacgcgacaacaaagactctcta
ttattgaaacaaatatgccagcattatgcaggcctggactatattagtggaggtgtatac
ggctttggtcataataataatattgcggtggcgtatgtaaaggaaaaatatagacccgca
gatgatgattacattttgtttttgaatcccgatatcatcatgaagcatgatgatttgctg
acatatattaaatatgtcgaaagtaagcgttatgcttttagtacattatgcctgttccga
gatgaagcgaaatctttacatgattattccgtaagaaaatttcctgtgctttctgatttt
attgtgtcatttatgttagggattaataaaacaaaaattcctaaagaaagtatctattct
gatacggttgttgattggtgcgcaggatcatttatgctggtacgtttttcagattttgtg
cgtgtaaatggcttcgatcaaggttactttatgtactgtgaagatattgacctgtgcttg
aggcttagcctggctggtgtcagacttcattatgttcccgcttttcatgcgatacattat
gctcatcatgacaatcgaagttttttttcaaaagccttcagatggcacttaaaaagtact
tttagatatttagccagaaaacgtattttatcaaatcgcaactttgatcgaatttcatca
gtttttcacccgtaa
              
                            

Download fasta file
RegulonDB