RegulonDB RegulonDB 10.9: Gene Sequence
yehE gene sequence


Size: 282        A: 73  T: 85  G: 64  C: 60

Fasta

 

>yehE E. coli K12. Version NC_000913.3 GI:556503834
atgaataagtattggctgtcaggaattatttttcttgcctatggattggcttctcccgca
ttctcttcagagactgccacattagcgattaatggcaggatcagtcccccaacatgcagt
atggctatggttaatggtcaacctcaacagcattgtggtcagttaacgtataatgttgac
acccgtcatctgttttcttcgcccgtcaaaggtgtaacgacagaagtggttgttgcaggt
agcgatagcaaacgtcgaatcgtgttaaatcgctacgattaa
              
                            

Download fasta file
RegulonDB