RegulonDB RegulonDB 10.9: Gene Sequence
yehR gene sequence


Size: 462        A: 150  T: 116  G: 102  C: 94

Fasta

 

>yehR E. coli K12. Version NC_000913.3 GI:556503834
atgaaggctttcaataagctgttttccctcgttgttgcatctgttctggttttctctctt
gctggctgcggtgacaaagaagaatcgaagaaattcagcgccaatctgaacggcactgaa
attgccattacctatgtctacaaaggtgacaaggtgcttaagcaatcttctgaaaccaaa
attcaatttgcctccattggtgcaaccaccaaagaagatgctgccaagacacttgagccg
ttaagcgccaaatacaaaaacatcgcgggtgttgaagaaaaattaacctataccgatacc
tacgcgcaggaaaacgtgactatcgatatggaaaaagtggattttaaagccctgcagggt
atttcaggaatcaacgtttctgctgaagatgccaaaaaaggtatcactatggcgcaaatg
gaactggtgatgaaagccgctggttttaaagaagtgaaataa
              
                            

Download fasta file
RegulonDB