RegulonDB RegulonDB 10.9: Gene Sequence
btsR gene sequence


Size: 720        A: 182  T: 183  G: 202  C: 153

Fasta

 

>btsR E. coli K12. Version NC_000913.3 GI:556503834
atgattaaagtcttaattgtcgatgatgaaccgttagcacgggagaacctgcgtgtattt
ttgcaggagcagagcgatattgaaatcgttggagagtgttcaaacgccgtggaagggatc
ggcgcggtgcataaactgcgcccggatgtgctgtttctcgatatccagatgccgcgcatc
agtggtctggaaatggtggggatgcttgacccggaacatcgcccgtatattgtttttctc
actgcgtttgacgaatacgcaattaaagcctttgaagaacatgcctttgattatctgctg
aagccaattgatgaagcgcgactggagaaaacgctggcgcgattgcgtcaggagcgcagc
aagcaggatgtttcgctgttaccggaaaatcaacaggcgctgaaatttatcccttgtacg
gggcatagtcggatttatttgctgcaaatgaaagatgtggcatttgtcagcagtcggatg
agcggtgtctacgttaccagccacgaagggaaagagggctttaccgaattgacattacgt
accctggaaagtcgtacaccactactgcgctgccatcgtcagtatctggttaacctcgcg
catttacaggagattcgtctggaagataacggccaggccgagttgattttgcgtaatggc
ttaaccgtgccggtcagccgccgttatctgaaaagcttaaaagaggcgattggcctgtaa
              
                            

Download fasta file
RegulonDB