RegulonDB RegulonDB 10.9: Gene Sequence
btsS gene sequence


Size: 1686        A: 400  T: 433  G: 451  C: 402

Fasta

 

>btsS E. coli K12. Version NC_000913.3 GI:556503834
atgtacgattttaatctggtgttgctgctgcttcagcagatgtgcgtttttttagtcatt
gcatggttaatgagtaaaacgccattattcataccgttaatgcaggtcacggttcgtctg
ccgcataaatttctctgctacatcgtcttttccatcttctgcatcatgggcacctggttt
gggttgcacattgacgattctattgccaatacccgtgcgataggcgcggtaatgggcggc
ttactcggcggtccggtcgtcggtgggctggttgggctgaccggcggcttacatcgatat
tcgatggggggcatgaccgcgttaagttgcatgatctcgaccatcgttgaaggattactc
ggtggcctggtacacagcatcctgatccgccgcgggcgcactgataaagtctttaacccc
attaccgccggtgccgtcacgttcgtcgctgaaatggtgcaaatgctgatcatccttgcg
atcgcccgaccttatgaagatgcggtgcgtctggtgagtaatattgctgcgccaatgatg
gtcaccaataccgtcggcgcggcgctgtttatgcgtatattgctcgataaacgcgcgatg
tttgaaaaatacacttcggctttttctgccactgcgctgaaagtggcagcctcgacggaa
ggcattttgcgccaggggtttaacgaagtgaacagcatgaaagtggctcaggtgctgtat
caggaactggatattggtgcagtcgcgattaccgatcgagagaaattgctggcctttacc
ggaattggtgacgaccaccatttacccggcaaaccgatttcttcaacttatactttaaaa
gcgattgaaaccggtgaagtggtctacgctgatggcaacgaagtaccttaccgttgctct
ttgcatccgcaatgcaaactggggtcgacgctggtaattccgttgcgtggtgaaaatcag
cgggtgatgggcaccatcaaattgtatgaagccaaaaaccgtttattcagttcaatcaac
cgcacgttgggtgaggggattgcgcaattgctttcggcgcagatccttgccgggcaatat
gagcggcaaaaagcgatgctcacccagtcagagatcaaactgcttcacgcccaggtgaat
ccccattttttgtttaatgcgcttaacaccattaaagcggtgatccgccgcgacagcgaa
caggccagccagctggtgcagtatctttccacttttttccgcaaaaacttaaagcggcct
tcggagtttgttactctcgccgacgaaattgaacatgtgaatgcttatctgcaaattgaa
aaggcgcgcttccagtcgcggttgcaggtcaacattgctattccgcaagaattatcccag
cagcaattgcccgcgtttaccctgcaaccgatagtggaaaacgccattaaacatgggaca
tcacaactgctggatacagggcgagtggcaatcagcgcccgacgtgaggggcaacatttg
atgctggagatcgaagacaatgccggtttgtatcaaccggtaaccaatgccagtgggctg
gggatgaatctggtggataagcgtttacgtgaacggtttggcgatgactatggaataagc
gtcgcctgtgagcctgatagttacacccgaataacgttacgactaccatggagggacgag
gcatga
              
                            

Download fasta file
RegulonDB