RegulonDB RegulonDB 10.9: Gene Sequence
mlrA gene sequence


Size: 732        A: 185  T: 160  G: 192  C: 195

Fasta

 

>mlrA E. coli K12. Version NC_000913.3 GI:556503834
atggcgctttacacaattggtgaagtggcgttgctttgtgatattaatcctgtcacgtta
cgcgcgtggcagaggcgttacggattgctgaaaccgcaacggacagacggcggtcatcgg
ctgttcaacgatgccgatattgaccggatccgcgagatcaaacgctggatcgacaacggc
gtgcaggtcagcaaagttaaaatgctgctcagtaatgaaaatgttgatgtgcagaacggc
tggcgcgatcagcaagaaacattactgacttacctgcaaagcggcaatctacatagcctg
cgaacgtggatcaaagagcgcggtcaggattaccccgcccagacactcaccacacatctg
tttattcctctgcgccgacggcttcagtgccaacaaccgactctccaggcgctgctggcg
atcctcgacggcgtactgatcaactacatcgccatttgtctggcttcggcacgtaaaaaa
cagggtaaagatgcgctggtggttggctggaatattcaggataccacccgtctgtggctg
gagggctggattgccagtcaacaaggatggcgcattgatgtcctcgcccactcgctcaat
caactacgccctgaactattcgaaggccgtacattgctggtgtggtgcggtgaaaatcga
acctccgcccaacagcagcaactcaccagttggcaagaacaaggccatgatattttccca
ctcggcatttaa
              
                            

Download fasta file
RegulonDB