RegulonDB RegulonDB 10.9: Gene Sequence
pbpG gene sequence


Size: 933        A: 245  T: 215  G: 240  C: 233

Fasta

 

>pbpG E. coli K12. Version NC_000913.3 GI:556503834
atgccgaaatttcgagtttctttatttagcctggccctgatgctggctgtgccttttgca
ccgcaggccgttgcgaaaacggcagccgctaccaccgcttcacaaccggaaattgcctcc
ggtagcgcgatgattgttgatctgaataccaacaaagtgatctattcgaaccacccggat
ctggtgcgtccgattgcgtctatcagcaaattaatgaccgcgatggttgtgctggatgca
cgactgccgctggatgaaaaactaaaagtggatatcagccagacgccggagatgaaaggg
gtctattcgcgcgtacgactgaatagcgaaatcagccgtaaagatatgctgttgctggcg
ctgatgtcttcagaaaaccgcgcggcggcaagccttgcgcaccattatcccggtggttac
aaagcctttattaaggcaatgaatgcgaaagcgaaatcgctcggaatgaacaacacgcgc
tttgttgaacctaccggattgtcggtgcataacgtttcaactgcccgtgacttaaccaaa
ctgctcattgccagcaaacaatatccgttgatcgggcagttaagtactacccgggaagat
atggcaaccttctctaatccgacgtatacgctgccgttccgcaatactaatcatctggtg
tatcgcgataactggaatattcagttaaccaaaaccggctttaccaatgcggcgggccat
tgtctggtgatgcgtacggttatcaataataaaccggtggcgctggtagtgatggacgcg
tttggcaaatatacccattttgccgatgccagccgcctgcgtacctggattgaaaccggt
aaagtgatgcctgtgccggcagcagcgttgagctataaaaaacaaaaagccgcccaaatg
gcggcggcggggcagacggcacagaacgattaa
              
                            

Download fasta file
RegulonDB