RegulonDB RegulonDB 10.9: Gene Sequence
yohC gene sequence


Size: 588        A: 98  T: 175  G: 171  C: 144

Fasta

 

>yohC E. coli K12. Version NC_000913.3 GI:556503834
atgagccatgtctggggactgttttcccatcccgatcgtgaaatgcaggtgattaatcgc
gaaaacgaaacgatttctcaccattacacccaccacgttttgctgatggcggcgattccg
gtgatttgcgccttcattggcactacacagattggctggaattttggcgatggcactatc
ctgaagttatcctggtttaccggactggcgctggctgtcttgttttacggcgttatgctg
gctggggtcgcggtgatggggcgggtcatctggtggatggcgcgtaattatccgcagcgt
ccgtcacttgcgcactgcatggtcttcgcgggctacgttgcaactccgctgtttttaagc
ggtctggtggcgctttatccactggtctggttgtgtgcgctggtcggcacggtggcgctg
ttttacaccggctacctgctttaccttggtattccgagcttcctgaatatcaacaaagag
gaaggccttagcttctctagttcgacgctggcgattggcgtgctggtactggaagtgctg
ctcgccctaaccgttatactatggggctacggttatcgtttgttctag
              
                            

Download fasta file
RegulonDB