RegulonDB RegulonDB 10.9: Gene Sequence
yohD gene sequence


Size: 579        A: 106  T: 158  G: 183  C: 132

Fasta

 

>yohD E. coli K12. Version NC_000913.3 GI:556503834
atggatctcaatacacttatctcacaatatggttatgccgcgctggtgatcggtagcctg
gcggaaggtgaaaccgtgactttgctgggaggcgttgcggcgcatcaggggctattaaag
ttcccgctggtggtactttctgtggcgcttggcggcatgattggcgaccaggtgctctat
ctgtgcgggcggcggtttggcggcaagctgttacgccgtttctcgaaacatcaggataaa
attgagcgggcgcagaaacttatccaacgccatccgtatctgtttgtcattggtacgcgc
tttatgtatggctttcgggtgattggcccgacgctgattggtgccagccagctgccgccg
aaaatctttctgccgctgaatattctcggcgcatttgcctgggcgttgatttttaccact
attggttacgctggtggtcaggtgattgcgccgtggttgcacaatctcgaccagcatttg
aagcactgggtctggttgattctggtcgtggttctggtggtgggcgtgcgctggtggctg
aaacgacgcgggaagaaaaagccggatcatcaggcgtaa
              
                            

Download fasta file
RegulonDB