RegulonDB RegulonDB 10.9: Gene Sequence
yohF gene sequence


Size: 762        A: 171  T: 171  G: 243  C: 177

Fasta

 

>yohF E. coli K12. Version NC_000913.3 GI:556503834
atggcacaggttgcgattattaccgcctccgattcggggatcggcaaagagtgcgcgtta
ttactggcgcagcaggggtttgatattggtattacctggcactcagatgaagaaggggca
aaagataccgcgcgtgaggtagttagccacggcgtacgtgcggagatcgtgcagctggat
ctcggcaatctaccagaaggggcactggcgctggagaaactcattcaacggctggggcgc
attgatgtgctggtgaataatgcgggtgcaatgaccaaagcgccgtttcttgatatggct
tttgatgagtggcgcaagatttttaccgttgatgtcgatggtgcattcttatgctcgcaa
attgcggctcgtcagatggtgaaacaagggcagggcggtcgcatcatcaacattacgtcg
gtacatgaacatacgccgctgccggatgccagcgcctacacagccgctaaacatgcgctc
ggtgggttaaccaaagcgatggcgctggagctggtcaggcataagattttggtgaacgca
gtcgcgcctggggcgatcgccacgccaatgaatggcatggatgacagcgacgtgaagccc
gacgcggagccttcgattcccttgcggcgttttggcgcaacgcatgagattgccagcctg
gtggtgtggctttgttcggagggcgcaaattacaccaccgggcagtcgttgatagtggat
ggcggctttatgttggcgaatccacagttcaacccagaatag
              
                            

Download fasta file
RegulonDB