RegulonDB RegulonDB 10.9: Gene Sequence
mdtQ gene sequence


Size: 1436        A: 351  T: 293  G: 415  C: 377

Fasta

 

>mdtQ E. coli K12. Version NC_000913.3 GI:556503834
atgaatcgtgattccttttatccagccatcgcctgttttccgctgttactgatgctggcc
gggtgtgcgcctatgcatgaaacccgccaggcgttaagccagcaaacgcccgctgcacaa
gttgacaccgcattacccacggcgctgaaaatggttggccagacagccaatggtggctgg
agtatcacgataatcaactcacttccttaattaacaatgcactacagaacgcaccggata
tgcaggtggctgaacagcgcattcagctagctgaagcccaggcgaaggcagttgccactc
aggatggtccgcagatcgacttttcggcggatatggagcggcaaaaaatgtcggcagaag
gcttaatggggccgtttgctctgaacgatccggccgcaggtacgaccggcccgtggtaca
ccaacggtacttttggcttaacggcgggctggcatctcgatatctggggaaagaatcggg
cggaggttactgcccgcctgggtacggttaaagcacgggcggcggaacgcgagcaaaccc
gccaattgctggctggcagcgtagcccgcctgtactgggagtggcaaacccaggcggcgt
taaacacggtcttgcagcaaatagaaaaagagcagaacaccattatcgcgaccgatcgcc
agctatatcagaacgggattacttcttcagttgaaggtgtggaaaccgatattaatgcca
gcaaaacccggcagcagctcaacgatgtcgcggggaaaatgaaaattattgaggcacggt
taagcgcacttacaaataaccagacaaagtcattgaagcttaaaccggtcgcgttgccga
aagtggcaagccagcttcctgatgaactggggtactccttactggcccggcgggcagatt
tgcaggcggcgcactggtacgttgagtcatcgctaagcaccattgatgcggcaaaagcgg
cattttatcctgacatcaacctgatggccttcctgcaacaggatgcgttgcacttaagcg
atctgttccgtcattccgcgcagcaaatgggcgttacggcaggcctgacgctacccattt
tcgatagtggtcgtcttaacgccaatctcgatatcgcaaaagccgaaagcaacttgtcta
tcgccagctacaacaaagcggtggttgaagcggtgaatgacgtggcgcgggcagccagtc
aggttcagacactggcggagaaaaaccagcatcaggcgcaaattgagcgcgatgccttgc
gtgtggtaggtcttgcgcaggcgcgctttaacgcgggcatcattgctggttcccgcgtca
gcgaagccagaatccccgcgctgcgtgagcgggccaatggcctgttattgcaagggcagt
ggctggatgcctccattcaactcactggtgcgttgggcggggggtacaaacgctga
              
                            

Download fasta file
RegulonDB