RegulonDB RegulonDB 10.9: Gene Sequence
dusC gene sequence


Size: 948        A: 221  T: 213  G: 300  C: 214

Fasta

 

>dusC E. coli K12. Version NC_000913.3 GI:556503834
atgcgtgtgttactggcaccgatggagggagtgcttgactctctggtgcgtgaattgctg
accgaagttaacgactacgatctgtgcatcaccgagtttgtccgcgtggtggatcaactg
ctgccggtaaaagtctttcatcgcatttgccctgagctacaaaacgccagccggacacca
tctggtacgctggtgcgcgtgcagttgttaggtcagttcccacaatggctggcagagaac
gccgcccgtgcggtggagttaggttcctggggcgtggatctcaattgcggctgcccgtcg
aaaacggttaacggtagcggcggcggggcgacgttactcaaagatcctgaactcatctac
cagggtgcaaaagcgatgcgtgaagctgtaccggcgcatttgcccgtcagcgtgaaagtg
cgtctgggctgggacagcggtgagaagaaatttgaaatcgccgatgcggttcaacaggct
ggcgctacggagctggtggtgcatgggcggacgaaagagcagggttaccgcgcggagcat
attgactggcaggcgattggcgatattcgccagcggctgaatattccggtgattgccaac
ggtgaaatctgggactggcagagcgcgcaacaatgcatggcgatcagcggctgcgacgca
gtgatgattggtcgcggggcgctcaatattcccaacctgagccgggtggtaaaatataac
gaaccgcgaatgccgtggccggaggtggttgctttgctgcaaaaatatacccgtctggaa
aagcagggcgataccgggttatatcacgttgcgcggattaaacagtggttgagttatttg
cgtaaagaatacgatgaagcaacggaattatttcagcatgttcgggtgttgaataattcc
cctgatattgcaagggctattcaggcaattgatatcgagaaactctaa
              
                            

Download fasta file
RegulonDB