RegulonDB RegulonDB 10.8: Gene Sequence
yohJ gene sequence


Size: 399        A: 80  T: 122  G: 109  C: 88

Fasta

 

>yohJ E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagacactgaacattatctggcaatatttacgcgctttcgtcctgatttatgcc
tgcctgtatgcaggcattttcattgcttccctgctaccggtaaccattccgggcagcatc
atcgggatgctgatcctgtttgtcctgctggccttgcaaattcttccggcaaaatgggtc
aatccggggtgctacgtactgattcgctatatggcgctattgtttgtgccgattggcgta
ggcgtcatgcaatattttgatttgctccgcgcacagtttggcccggtagtggtttcctgt
gcagtcagtacgctggtggtttttctggtggtgagctggagttcgcaactggtacacggt
gaacgtaaagtcgtaggtcagaaaggatcagaagaatga
              
                            

Download fasta file
RegulonDB