RegulonDB RegulonDB 10.9: Gene Sequence
yeiG gene sequence


Size: 837        A: 192  T: 189  G: 234  C: 222

Fasta

 

>yeiG E. coli K12. Version NC_000913.3 GI:556503834
atggaaatgctcgaagagcaccgctgttttgaaggctggcagcaacgctggcgacacgac
tccagtaccttaaactgcccgatgacgttcagtatctttctccctccacctcgtgatcac
actccgccaccagtgctgtactggctttccggattaacctgcaatgacgagaacttcacc
accaaggcgggtgcccagcgggtagcggcggaactggggattgtactggtgatgccagac
accagcccgcgcggcgaaaaggttgccaacgacgatggctacgatttaggccagggcgca
ggcttttatcttaatgccacgcaaccgccgtgggcgacgcattaccggatgtatgattat
ctgcgcgatgaattaccggcgctggttcagtcgcaatttaatgtcagcgaccgctgcgcc
attagcggtcactcaatgggtggtcacggtgcgctgattatggcgctgaaaaatccgggt
aaatacaccagcgtttcggcctttgcgccaattgtgaatccgtgcagcgtcccgtgggga
atcaaagcgtttagcagctatttaggtgaggacaaaaatgcatggctggaatgggacagt
tgcgcactgatgtatgccagtaacgcgcaggatgcgatcccgacgcttatcgatcagggc
gataatgatcagtttcttgccgaccagttgcaacctgcggtactggcagaagccgcgcgc
cagaaagcgtggccgatgacgctgcgtattcagccgggatatgatcacagttactacttc
atcgcctcttttatagaggatcacctgcgcttccatgcgcagtatttactgaagtga
              
                            

Download fasta file
RegulonDB