RegulonDB RegulonDB 10.10: Gene Sequence
yeiI gene sequence


Size: 1089        A: 260  T: 265  G: 296  C: 268

Fasta

 

>yeiI E. coli K12. Version NC_000913.3 GI:556503834
atgaataaccgggaaaaggagatccttgcaattttacggcgtaacccgctgattcagcag
aacgaaattgcggacatgctgcaaatcagccgttcgcgcgttgcggcgcatattatggat
ttaatgcgcaaaggccggattaaaggcaaaggttacattctcaccgagcaggaatactgc
gtagtggtggggacaatcaatatggatattcgcgggatggcggatatccgttacccgcaa
tcggcttctcatcccggtacaattcattgctcagcgggcggcgtgggacgcaacatcgcc
cacaatctggcgctgttaggccgtgacgtccatttgctttcagtgattggcgatgacttt
tatggcgaaatgctcctggaagaaacgcgccgtgccggcgtgaatgtctccggctgcgtt
cgtttgcatggtcaaagcacatcgacgtatctggcaattgccaatcgagacgatcaaacc
gtgctggcgattaacgatacccatctgctggaacagttgacaccgcaactactgaacggg
tcgcgcgatttacttcgtcatgcgggcgtggtactggctgattgcaacctgacagccgag
gcgctggaatgggtctttaccctcgctgatgaaatcccggtgtttgtcgataccgtttca
gaattcaaagcgggcaaaatcaaacactggctggcgcatattcacaccctgaaacccact
ttaccggagctggaaattttatggggacaggcgatcaccagcgatgctgaccgtaatacc
gcagtgaatgcattgcatcagcaaggtgttcagcaactgtttgtttatttgcccgatgag
tcagtttattgcagcgaaaaggatggagaacaatttttgctgaccgcgccagcgcatacg
acagtagacagttttggtgctgacgatggttttatggcgggcctggtatatagctttctt
gaaggatacagtttccgcgacagcgcccgttttgcggtagcctgcgcggcaatttcgcgc
gccagcggcagcttaaacaaccctaccctgtctgccgataacgcgctttcattagtgcca
atggtgtaa
              
                            

Download fasta file
RegulonDB