RegulonDB RegulonDB 10.9: Gene Sequence
nupX gene sequence


Size: 1251        A: 252  T: 368  G: 359  C: 272

Fasta

 

>nupX E. coli K12. Version NC_000913.3 GI:556503834
atggatgtcatgagaagtgttctgggaatggtggtattgctgacgattgcgtttttactg
tcagtaaacaagaagaagatcagcctgcgtaccgttggcgcggcgttagtgttacaggtc
gtgattggcggcattatgctttggttaccgccagggcgttgggtcgctgaaaaagtcgct
tttggcgtgcataaagtgatggcgtacagcgacgcgggtagcgcatttatcttcggttct
ctggtcggaccgaaaatggataccttatttgatggtgcaggatttatctttggtttcagg
gtgttaccggcaattatcttcgtcaccgcgctggtgagtattctctactacatcggtgtg
atggggattttaattcgaattctcggcggtatcttccagaaagcattaaatatcagcaag
atcgagtcattcgtcgcggtcaccaccattttcctcgggcaaaacgaaattccggcaatc
gtcaaaccctttatcgatcgtctgaatcgcaatgaattatttacagcgatttgtagtggc
atggcctcgattgctggttcgacaatgattggttacgccgcactgggcgtgcctgtggaa
tatctgctggcggcatcattaatggcgatccctggcgggatcttgtttgcccgcctgtta
agcccggcaacggaatcttcgcaggtttcctttaataacctctctttcaccgaaacaccg
ccaaaaagcattattgaagccgctgcgacaggggcaatgaccgggctgaaaatcgccgca
ggtgtggcaacagtggtgatggcatttgttgcaataattgcgttgattaacggtattatc
ggcggcgttggtggctggtttggttttgaacatgcctcgctggagtccattttaggttac
ctgctggctccactggcgtgggtgatgggtgtggactggagtgatgcgaatcttgccggg
agtttgattggacagaaactggcaataaatgaatttgtcgcttatctcaatttctcaccc
tatctgcaaacggctggcactctcgatgctaaaactgtggcgattatttccttcgcgttg
tgcggtttcgctaactttggttctatcggggtggtggtgggggcgttttctgcggttgcg
ccacaccgtgcgccggaaatcgcccagcttggtttacgggcgctggcggcggcgacgctt
tccaacttgatgagtgcgaccattgccgggttctttattggtttagcttga
              
                            

Download fasta file
RegulonDB