RegulonDB RegulonDB 10.10: Gene Sequence
rihB gene sequence


Size: 942        A: 235  T: 217  G: 251  C: 239

Fasta

 

>rihB E. coli K12. Version NC_000913.3 GI:556503834
atggaaaagagaaaaattattctggattgtgatccgggtcatgatgatgctattgctata
atgatggcggcgaaacatccggcaatagatttattaggcatcactattgtagcgggtaat
cagacgcttgataaaacattaattaatggcctgaatgtttgccagaaactggagattaat
gttccggtttatgcggggatgccgcagcccattatgcgtcaacaaatcgttgccgataat
attcacggtgaaaccggactggatggcccggtattcgagccgctgacccgccaggcagaa
agcactcatgcggtgaaatatatcattgataccctgatggcaagcgatggcgatatcact
ctggtgccggttggtccgctttcaaatatcgcggtggcaatgcgtatgcaacccgcgatc
ctgcccaaaatccgtgaaattgtgctaatgggcggcgcttacggtacaggcaacttcacg
ccatctgccgagttcaacatctttgccgacccggaagccgcacgcgtagtgttcacctcc
ggcgttccattagtgatgatgggcctcgatctcaccaaccagaccgtttgcaccccggac
gtgattgctcggatggaaagggcaggcggccccgccggagagctgttcagcgacatcatg
aacttcactctcaaaacgcagttcgaaaactacggccttgctggcggcccggtgcacgac
gccacctgcatcggttatctgattaaccctgatggcattaaaacccaggagatgtacgtc
gaagtggacgtcaacagtggcccttgctatgggcgtaccgtctgcgacgagctgggcgtt
cttggcaagcccgccaataccaaagtcggcatcactattgatacagactggttctgggga
ttagtcgaagagtgcgtgcgcggctacatcaaaacccattaa
              
                            

Download fasta file
RegulonDB