RegulonDB RegulonDB 10.9: Gene Sequence
yeiL gene sequence


Size: 660        A: 168  T: 195  G: 155  C: 142

Fasta

 

>yeiL E. coli K12. Version NC_000913.3 GI:556503834
atgagtgaatccgcgtttaaggattgctttttaacggatgtttcagccgatacgcggctg
tttcattttttagcgcgtgactacattgtgcaggaagggcaacagccgtcctggctgttt
tacctgacgcgaggccgcgccaggctttacgccacgctagctaatggtcgcgtgtcgctg
atcgatttctttgccgccccctgttttattggcgagattgagttaatcgataaagaccat
gaaccgcgtgcggtgcaggctattgaagagtgttggtgccttgcgctccctatgaaacat
taccgtccgctgttattaaacgacacgctatttttacgaaaactctgcgtcaccttaagt
cataaaaattatcgtaatattgtttctttaactcagaatcaatcatttccgttagtgaat
cgcctggcagcatttatattactctcgcaggaaggtgatctttatcacgaaaagcatacg
caagcggcagagtatttaggcgtttcttatcgacatcttttatatgttctcgcgcagttc
attcacgacggtttattaattaaaagcaagaaagggtatctcattaaaaacagaaagcag
ttgtcaggactggcgctggagatggacccggagaataaattctccgggatgatgcagtaa
              
                            

Download fasta file
RegulonDB