RegulonDB RegulonDB 10.9: Gene Sequence
psuG gene sequence


Size: 939        A: 244  T: 228  G: 249  C: 218

Fasta

 

>psuG E. coli K12. Version NC_000913.3 GI:556503834
atgtctgaattaaaaatttcccctgaattattacaaatttccccggaagtgcaggacgct
ttaaaaaacaaaaaaccggttgtggcgctggaatcgaccattatttctcacgggatgccg
ttcccacaaaatgcccagaccgcaattgaagttgaagaaactattcgtaaacagggcgct
gtacctgccacgatcgccattattggcggcgtgatgaaagtggggttaagcaaagaagaa
attgaattactgggtcgtgaagggcataacgtgaccaaagttagtcgtcgcgatttacct
tttgttgttgccgccggaaaaaatggcgcaaccactgtggcttcaacgatgattattgcg
gcgcttgccggaattaaagtatttgccaccgggggaattggtggtgtgcatcgcggggcg
gaacataccttcgatatttctgccgatttgcaagaactggcaaatactaatgtcaccgtt
gtttgtgccggggcgaaatctattctcgatttaggattaaccactgagtatttagaaacc
ttcggtgtgccgttaattggctatcagactaaagcgctgcctgcgtttttctgccgcacc
agcccgtttgacgtcagcattcgtctcgacagcgccagcgaaattgcccgtgcaatggtg
gtgaaatggcaaagcggtctgaacggtggcctcgtggtagcgaacccgatcccggaacag
tttgctatgccggaacacactatcaatgcggcgatcgatcaggcggtagctgaagctgaa
gctcagggagtcattggtaaagaaagtacgccattcctgctggcgcgcgttgctgaactg
accggcggtgacagcctgaaatccaacatccagctggtgttcaacaacgccattctggcg
agcgaaattgccaaagaatatcagcgtctcgcgggttaa
              
                            

Download fasta file
RegulonDB