RegulonDB RegulonDB 10.9: Gene Sequence
setB gene sequence


Size: 1182        A: 207  T: 348  G: 325  C: 302

Fasta

 

>setB E. coli K12. Version NC_000913.3 GI:556503834
atgcataactcccccgcagtctccagcgcgaaatcgtttgacctgacctcgacggcgttt
ttaatcgttgcctttctcaccggtattgcgggcgctctgcaaaccccgacactcagtatt
tttcttaccgatgaagtacatgcccgtccggcgatggtgggattcttctttaccggcagc
gctgtcattgggattctggtaagtcagtttctcgccgggcgctctgataagcgcggcgat
cgcaaatcgctgattgtcttttgctgcctgttaggcgtgctggcctgcaccctttttgcc
tggaatcgcaactactttgttttgctattcgttggcgtctttcttagcagctttggctcg
accgctaacccgcaaatgtttgcccttgcccgtgaacatgccgacaaaaccggacgtgag
gcggtgatgttcagctcttttttacgcgctcaggtttcactggcatgggtcattggccca
ccgctggcttatgccttagcgatgggtttcagctttacggtaatgtatctgagcgcagcg
gtagcgtttattgtttgcggtgtgatggtgtggctgtttttaccgtcgatgcgaaaagag
cttccgctggcgaccggcacgatcgaagcgccgcgccgtaaccgtcgcgatacgctgctg
ctgtttgtcatttgtacattgatgtggggctcgaacagcctgtacatcatcaacatgccg
ctatttattatcaacgaactgcatcttcccgagaaactggccggtgtgatgatggggacc
gccgccgggctggaaatcccgacgatgttgattgccggatatttcgccaaacgtctgggt
aagcgtttcttaatgcgcgttgctgccgtgggtggcgtctgtttttacgcaggaatgctg
atggcgcattcacctgtcattctgttgggcttgcagctgctaaatgctatttttattggc
attctgggcggcatcgggatgctctattttcaggatctgatgcccggtcaggcgggttca
gccaccacgctctataccaacacttcgcgcgtgggctggatcatcgcaggatcagtggcg
ggcatcgtcgccgagatctggaattatcacgctgtgttctggtttgcgatggtgatgatt
atcgccactctgttttgcttactgcggattaaagatgtttaa
              
                            

Download fasta file
RegulonDB