RegulonDB RegulonDB 10.9: Gene Sequence
yeiP gene sequence


Size: 573        A: 156  T: 131  G: 152  C: 134

Fasta

 

>yeiP E. coli K12. Version NC_000913.3 GI:556503834
atgccaagagcgaacgaaattaaaaaaggtatggtactgaattacaacggcaaactgctg
ctggttaaggatattgatattcagtcgcccactgcccgcggtgccgctacgctgtacaaa
atgcgtttttctgatgtccgtaccgggctgaaagtagaagagcgtttcaaaggtgatgat
atcgttgacaccgtgacgctgacccgccgttacgttgacttctcctatgtcgatggcaac
gaatatgtctttatggataaagaagactataccccgtataccttcaccaaagatcagatt
gaagaagagttgctgtttatgccagagggcggcatgccggacatgcaggtgctgacctgg
gacggtcaactgctggcgcttgagctgccgcagaccgttgatctggaaatcgttgaaacc
gcaccaggcatcaaaggggcatctgccagcgcccgtaacaaaccggcgacattgagcact
ggtctggtgattcaggtaccagaatacttaagcccgggcgaaaaaattcgtatccatatc
gaagaacgccgttatatggggcgtgctgactaa
              
                            

Download fasta file
RegulonDB