RegulonDB RegulonDB 10.9: Gene Sequence
yejE gene sequence


Size: 1026        A: 185  T: 300  G: 281  C: 260

Fasta

 

>yejE E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcgactcagccccgtcaatcaggcccgttgggcgcgttttcgtcataaccgtcgc
ggctactggtcgttatggattttcctcgtcttgtttggtttgagtttgtgttctgaactt
atcgccaacgataaaccgttgctggtgcgttatgacggcagttggtatttcccgttattg
aaaaactacagcgaaagcgattttggcggcccgctggcaagtcaggctgattatcaggac
ccgtggctgaaacaacggctggaaaataacggctgggtactgtgggcaccgattcgcttt
ggtgctaccagtatcaactttgctaccaataagcccttcccttctccaccctcccggcaa
aactggctgggaacggatgccaacggcggcgatgtgctggcacgcattctctatggcacg
cggatctcggttctgtttggcctgatgctgactctctgttccagcgtgatgggcgtgctg
gcgggggcgctacaaggctattacggcggtaaagtcgatctctggggacaacgctttatt
gaagtatggtcggggatgccgacgctgtttttgattattttactttccagcgtcgtacag
cctaacttctggtggctgctggcaattactgtcttgtttggctggatgagtctggtcggc
gtggtgcgggcggagtttttacgtactcgtaatttcgactacattcgtgcggcacaggcg
cttggcgtcagcgatcgcagtatcatcctgcgtcatatgttgcctaatgccatggtcgcg
accctcacctttttaccgtttattttatgtagttcgataaccaccctgacctcgctcgat
ttcctcggcttcggtctaccgctcggttcaccgtcactcggtgaactgctgttacaaggg
aaaaataaccttcaggccccgtggcttgggatcaccgccttcttgtcggtggcgatatta
ttgtctttgctgatctttattggtgaagccgtccgcgacgcatttgatcctaataaggcg
gtgtag
              
                            

Download fasta file
RegulonDB