RegulonDB RegulonDB 10.9: Gene Sequence
rsuA gene sequence


Size: 696        A: 162  T: 166  G: 189  C: 179

Fasta

 

>rsuA E. coli K12. Version NC_000913.3 GI:556503834
atgcgacttgataaatttatcgcacagcaactcggcgttagccgtgctattgccgggcgt
gaaatccgcggcaatcgtgtcaccgtcgatggcgaaatcgtccgtaatgcagcgttcaaa
ctgcttcctgaacatgatgtcgcttacgatggcaacccgctggcgcagcaacacggtcca
cgttacttcatgctcaataagcctcagggctatgtttgctccacggacgaccctgatcac
ccaacggtgctctattttcttgatgaaccggtagcgtggaaactgcatgcggcggggcgg
ttggatattgataccaccggtctggtgctgatgactgatgatggtcagtggtcgcaccgc
attacttctccgcgccatcattgcgagaagacctatctggtgacactggaatcacctgta
gctgacgatacggcagagcaatttgctaaaggcgtgcagctgcataacgaaaaagatctc
actaagcctgcggtgctggaagtgattaccccaacgcaggttcgtctgaccatcagcgaa
gggcgttatcatcaggtgaaacgcatgttcgccgccgtgggtaaccacgtggttgagctg
catcgtgaacgtattggcggtattacgctggatgctgatttagcccccggtgaatatcgt
ccgttaactgaagaagaaattgccagcgtcgtctaa
              
                            

Download fasta file
RegulonDB