RegulonDB RegulonDB 10.10: Gene Sequence
radD gene sequence


Size: 1761        A: 413  T: 412  G: 472  C: 464

Fasta

 

>radD E. coli K12. Version NC_000913.3 GI:556503834
atgatttttacacttcgcccatatcagcaagaagccgtggatgccacgctcaaccatttt
cgtcgtcataaaacccctgccgttatcgtgctgcccaccggcgcaggtaaaagcctggtg
atagcggaactggcacggctggctcgtggtcgcgtgctggtgctggcacacgttaaagaa
ctggtggcgcaaaaccatgcaaagtatcaggcgctggggctggaagccgatatttttgcc
gccgggctaaagcgcaaagagagccacggtaaagtggtatttggcagcgtgcagtctgtc
gcccgtaatcttgatgcctttcagggtgaattttcgctgttgattgtcgatgaatgtcac
cgtattggtgacgatgaagagagccagtatcagcaaatcctcactcacctgacaaaagtg
aatccccacttacgcctgctggggctgactgccacgccttttcgattgggcaaaggctgg
atctaccagtttcattatcacggcatggtacgcggcgatgagaaagcccttttccgtgac
tgcatttatgagctgccgctgcgttatatgattaaacacggctatctgacgccgccagaa
cgactggatatgccagtagtgcaatacgatttcagccgcttgcaggcacagagtaacggg
ctgttcagcgaagccgatctcaaccgtgagctgaaaaaacaacaacgtattaccccgcac
atcatcagccagattatggagtttgctgcaacgcgcaaaggggtgatgatttttgccgcg
acggttgaacacgcaaaagagattgtgggattactgcctgccgaagatgcagcactgatt
actggcgacacccccggcgctgagcgcgatgtgttaattgaaaattttaaagcccagcgt
tttcgctatctggtcaacgtcgcggtactgaccaccggatttgacgccccgcacgtcgat
cttatcgccattctgcgccctaccgaatcagtgagtctttaccaacaaattgtcgggcgc
ggtctgcgtctcgctccgggcaagactgattgcttaattcttgattatgcgggtaatcct
cacgatctctacgcgccggaagttggtacaccaaaaggcaaaagtgacaacgttccggta
caggttttctgccctgcctgcggttttgccaacaccttttgggggaaaacgaccgccgac
gggacattgattgaacactttggtcgtcgctgtcagggatggtttgaagatgacgacggt
catcgcgaacaatgtgacttccgtttccgttttaaaaattgcccgcaatgtaacgcggaa
aacgatattgccgcccgccgctgccgcgaatgtgacaccgtactggttgatccggacgat
atgttaaaagcggcgctacgactgaaagacgcgctggtattacgctgtagcggcatgtct
ttgcaacatgggcacgacgagaaaggcgaatggttgaaaatcacctattacgatgaagac
ggcgcggatgtgagtgagcgtttccgtctgcaaacacctgcccagcgtaccgccttcgag
cagctttttatccgcccgcatacgcgcacaccgggcatcccgctgcgctggatcaccgcc
gccgatatcctcgcccagcaagccttattgcgacacccggattttgtcgtcgcccgcatg
aaaggccagtactggcaggtgcgtgaaaaagtgttcgattacgaaggtcgttttcgtctg
gcgcacgaattacgcggttaa
              
                            

Download fasta file
RegulonDB