RegulonDB RegulonDB 10.10: Gene Sequence
lapC gene sequence


Size: 1761        A: 396  T: 448  G: 446  C: 471

Fasta

 

>yejM E. coli K12. Version NC_000913.3 GI:556503834
atggtaactcatcgtcagcgctaccgtgaaaaagtctcccagatggtcagttgggggcac
tggtttgcactgttcaatattctgctttcgctcgtcattggcagccgttacctgtttatc
gccgactggccgacaacgcttgctggtcgcatttattcctacgtaagcattatcggccat
ttcagcttcctggtgttcgccacctacttgctgatcctcttcccgctgacctttatcgtc
ggctcccagaggctgatgaggtttttgtccgtcattctggcaacggcgggaatgacgcta
ttactgatcgatagcgaagtctttactcgtttccatctccatcttaatcccatcgtctgg
caactggttatcaacccagacgaaaatgagatggcgcgcgactggcagctgatgttcatc
agcgtgccggttattttattgcttgaactggtgtttgcgacgtggagctggcaaaagctg
cgcagcctgacgcgtcgtcgacgcttcgcgcgcccgctggccgcattcttatttatcgcc
tttatcgcctcgcatgtggtgtatatctgggccgatgccaacttctatcgcccgatcacc
atgcagcgcgctaacctgccgctttcgtacccgatgacggcgcgacgttttcttgagaag
catggtctgcttgatgcgcaggagtatcaacgccgtcttattgagcaaggtaatccagac
gccgtttccgttcagtatccgttaagcgaactgcgctatcgcgatatgggcaccgggcag
aatgtgctgttgattactgtcgatggcctgaactactcacgcttcgagaagcagatgcct
gcgctggcaggttttgctgagcaaaatatttcgttcacgcgccatatgagctccggcaac
actacagacaacggcatctttggcctgttctatggcatctcgccgagctatatggacggc
attctgtcgacccgtacgcctgcggcattaattactgcgcttaatcagcaaggctatcag
ctggggttattctcatcagatggctttaccagcccgctgtatcgccaggcattgttgtca
gatttctcgatgccgagcgtacgcacccaatccgacgagcagaccgccacgcagtggatc
aactggctgggacgctacgcacaagaagataaccgctggttctcgtgggtttctttcaat
ggtactaacattgacgacagcaatcagcaggcatttgcacggaaatatagccgggcggca
ggcaatgtcgatgaccagatcaaccgcgtgctcaatgcactgcgtgattctggcaaactg
gacaatacggtggtgattatcactgccggtcggggtattccactgagcgaagaggaagaa
acctttgactggtcccacggtcatctgcaggtgccattagtgattcactggccaggcacg
ccggcgcagcgtattaatgctctgactgatcataccgatctgatgacgacgctgatgcaa
cgcctgctacatgtcagcacacctgccagcgaatattcgcaaggtcaggatttgttcaac
cctcaacgccgtcattactgggttaccgcagcggataacgatacgctggcaattaccacc
ccgaaaaagacgctggtactgaacaataacggtaaataccgcacttacaacttacgtggt
gaaagagtgaaagatgaaaaaccacagttaagtttgttattgcaagtgctgacagacgag
aagcgttttatcgctaactga
              
                            

Download fasta file
RegulonDB