RegulonDB RegulonDB 10.9: Gene Sequence
ccmF gene sequence


Size: 1944        A: 302  T: 532  G: 625  C: 485

Fasta

 

>ccmF E. coli K12. Version NC_000913.3 GI:556503834
atgatgccagaaattggtaacggactgctgtgcctggcgctgggaattgcgctgctgctg
tccgtgtatccgctatggggcgtggcgcgcggagatgcgcgcatgatggcgtcttcccgc
ttgtttgcctggctgctgtttatgtctgtggctggcgcatttctggtgctggtcaatgct
ttcgtggtcaacgacttcaccgtcacctatgttgccagcaactccaatacccagcttccg
gtgtggtatcgcgtggcggctacctggggcgcgcatgaaggctcgctactgctgtgggtg
ctgctgatgagcggctggacctttgcggtggcgatttttagtcagcgtattccgctggat
attgtggcccgtgtactggcgataatggggatggtcagtgtcggctttttgctgttcatt
ctctttacctctaacccgttctctcgcacgttgccgaacttcccgattgaaggtcgcgat
cttaacccgctattgcaggatccggggctgatcttccatccgcctctgctttatatgggg
tacgtgggtttctcggtggcgtttgcttttgccattgcttctttgctgagcgggcgtctg
gacagcacttatgcgcgttttactcgtccgtggacgctggcagcgtggatcttcctgacg
ctcggcatcgtgctcggttccgcatgggcctattacgaactcggctggggtggctggtgg
ttctgggatccggtagaaaacgcctcgtttatgccgtggctggtggggactgcgctgatg
cactcactggcggtcactgaacaacgcgccagcttcaaagcgtggacattactgctggca
atcagtgccttctcgttgtgtctgttggggactttcctcgtgcgttccggcgtgctggta
tcggtacacgcgtttgcgtctgatccggcgcgcggtatgtttatcctcgcctttatggtg
ctggtgattggcggttcgctgctgctgtttgccgcgcgtggacacaaagttcgctcacgc
gtaaacaatgcgctgtggtcgcgggaatctttgctgttagcgaacaatgttttgctggtc
gctgcgatgctggtggtgttgctggggacgctgctgccgttggtgcataagcaactggga
ctgggcagtatttcgattggcgaaccgttcttcaacaccatgtttacctggctgatggtg
ccgtttgcgctactgcttggtgtcggtcctctggtgcgctgggggcgggatcgcccgcgt
aagatccgcaatttattgattatcgccttcatctctacgctggtgctgtcgctgctgttg
ccgtggctgttcgaaagcaaagttgtggcgatgacggtgctcggcctggcaatggcctgc
tggattgcggtgctggcaattgcggaagctgcgctacgtatttcacgcggcacgaaaacc
accttcagttattgggggatggtggcggctcaccttgggctggcagtgacaattgttggc
attgcctttagccagaactatagcgttgagcgtgatgtgcgcatgaagtccggcgatagc
gtcgatattcatgaatatcgcttcaccttccgtgatgtcaaagaggtgactggcccgaac
tggcgtggcggtgtggcgactatcggcgtaacgcgcgatggcaagccggaaacggtgctg
tatgcggaaaaacgttattacaacactgccgggtcgatgatgaccgaagcggcaattgac
ggcggcatcacgcgtgacctgtacgcggccctcggtgaagagctggaaaacggcgcgtgg
gccgtgcgtctttactacaaaccatttgttcgctggatttgggcgggcgggctgatgatg
gcgttgggcggactgctgtgtctgtttgatcctcgctatcgtaagcgcgtgagtccgcaa
aaaactgcgccggaggccgtatga
              
                            

Download fasta file
RegulonDB