RegulonDB RegulonDB 10.9: Gene Sequence
ccmE gene sequence


Size: 480        A: 114  T: 109  G: 146  C: 111

Fasta

 

>ccmE E. coli K12. Version NC_000913.3 GI:556503834
atgaatattcgccgtaaaaaccgcttgtggattgcctgtgccgtgttggcagggctggcg
ctgactatcggtctggtgctatatgcgctgcgctcgaatatcgatctcttttatacgccg
ggggaaattctctacggcaagcgtgaaactcagcaaatgccggaagtcggtcagcgtctg
cgcgttggcgggatggtgatgccgggtagtgtgcagcgcgatcccaattcgctgaaagtg
accttcaccatttacgatgctgaaggctcagtggatgtctcttacgaaggcattttgccg
gatctgttccgtgaagggcagggcgttgtggtgcagggcgaactggaaaaaggcaatcat
atcctcgcgaaagaagtgctggcgaaacacgatgaaaactatacgccgccagaagttgag
aaagcgatggaagctaaccaccgtcgcccggcgagtgtttataaggacccagcatcatga
              
                            

Download fasta file
RegulonDB