RegulonDB RegulonDB 10.8: Gene Sequence
napC gene sequence


Size: 603        A: 157  T: 135  G: 174  C: 137

Fasta

 

>napC E. coli K12. Version NC_000913.3 GI:556503834
atgggaaattctgaccgtaagcctggtctgattaagcgcctgtggaaatggtggcgtacc
cccagccgtctggcgctggggacgctgctgttgatcggttttgttggcggcatcgtcttc
tggggtggctttaacaccgggatggaaaaagccaataccgaagagttctgcattagctgc
cacgaaatgcgcaacacggtgtatcaggaatacatggattccgtgcactacaacaaccgt
agcggcgtccgtgcgacctgtccggattgtcacgttccgcacgagtttgtgccgaagatg
atacgcaagctcaaagcaagtaaagagctgtatggtaaaatttttggcgttattgacacg
ccgcagaaatttgaagctcatcgtctgacgatggcacagaatgagtggcggcgcatgaag
gacaataactcgcaggagtgccgtaactgtcacaacttcgagtatatggatacaaccgcc
cagaaatcggttgccgcgaagatgcatgaccaggcggtgaaagatgggcaaacctgtatt
gattgccataaagggatagcgcacaagctgcccgatatgcgtgaagtcgagccaggtttt
taa
              
                            

Download fasta file
RegulonDB