RegulonDB RegulonDB 10.10: Gene Sequence
napH gene sequence


Size: 864        A: 153  T: 228  G: 268  C: 215

Fasta

 

>napH E. coli K12. Version NC_000913.3 GI:556503834
atggcaaatcgtaaacgtgacgccgggcgcgaggcgctggagaaaaaaggctggtggcgc
agtcaccgttggctggtgttacgtcgcctttgtcagttcttcgtgctggggatgtttttg
agcggtccatggtttggtgtgtggatcttgcacggcaactacagcagtagcctgttattc
gacaccgttccgctgaccgatccgctgatgacgctgcaaagtcttgccagtggtcatctg
cctgccacggtggcgttgaccggtgcggtgattatcaccgtgctctacgccctggcggga
aagcgattattttgcagctgggtctgcccgctgaacccgattaccgacttagcgaactgg
ttacgcaggcgctttgacctcaatcagtctgcgacgatccctcgccacattcgctacgtg
ctgttggtggtcattctggtgggatcagccttaactggcacgctcatttgggaatggatc
aaccccgtttctctgatggggcgtagcctggtaatgggcttcggcagcggcgcgctgctt
attctcgcgctgtttttatttgatctactggtcgttgaacacggctggtgcgggcacatt
tgtccggttggcgcgctgtatggcgtgctgggtagcaaaggtgtgattaccgttgcggcc
accgatcggcagaaatgtaaccgctgtatggattgttttcatgtttgcccggaaccgcat
gtgctacgtgccccggtgctggatgaacaaagcccggtgcaggtcaccagccgcgattgc
atgacgtgcggtcgctgcgtggatgtctgttctgaggatgtatttacaataactacacga
tggagttcgggagcgaaatcatga
              
                            

Download fasta file
RegulonDB