RegulonDB RegulonDB 10.9: Gene Sequence
napG gene sequence


Size: 696        A: 139  T: 146  G: 224  C: 187

Fasta

 

>napG E. coli K12. Version NC_000913.3 GI:556503834
atgtcccggtcagcgaaacctcaaaatggtcgccgccgctttctgcgcgatgtcgttcgc
acagcaggcgggctggctgccgtgggtgtggcgctggggttacaacagcaaaccgcacgc
gcatctggcgtgcggttgcgcccgcccggagccataaacgagaacgcctttgccagtgcc
tgtgtgcgttgcggtcagtgtgttcaggcttgcccttacgacaccttaaaactggcgacg
ctggcctctggtctgtcggcgggcacgccatattttgtcgcacgggatattccttgcgaa
atgtgtgaggacattccgtgcgccaaagtgtgcccaagcggtgcgctggatcgtgagatt
gaatcgatcgacgacgcgcggatggggctggcggtactggtggaccaggaaaactgtctc
aactttcaggggctgcgctgcgatgtttgttatcgcgaatgcccgaaaattgatgaggcc
atcaccctggagctggagcgcaacacgcgtaccggtaagcacgcccgctttctgccgacg
gttcacagcgacgcctgtaccggttgcggtaagtgcgaaaaagtatgcgtgctggaacaa
ccggcaatcaaggtgttaccgctgtcactggcgaaaggggagttaggtcaccattaccgc
ttcggctggctggaggggaacaatggcaaatcgtaa
              
                            

Download fasta file
RegulonDB