RegulonDB RegulonDB 10.9: Gene Sequence
yojI gene sequence


Size: 1644        A: 351  T: 415  G: 476  C: 402

Fasta

 

>yojI E. coli K12. Version NC_000913.3 GI:556503834
atggaacttcttgtacttgtctggcggcagtatcgctggccatttatcagtgtgatggcg
ctaagcctcgccagtgcggcattaggcattggcttaattgcttttatcaatcagcgcctt
atcgaaacggcggataccagtctgctggtgttgccggagtttctgggattattgctgctg
ttgatggcagtcactctcggatcgcaactggcgctcaccactttggggcatcacttcgtt
taccgactgcgtagtgaatttatcaagcggattctggatactcacgtcgagcgcattgaa
caactcggtagcgcctcgttgctggcggggttaaccagcgatgtgcgcaatatcaccatt
gcttttgtgcgtctgccggaactggtgcaggggatcattctcactatcggttcagcggcg
tatctgtggatgctgtcgggcaaaatgttgctggtaacggctatctggatggcgatcacc
atctggggcggttttgtgctggtggcgcgggtgtacaaacatatggcgaccctgcgtgaa
accgaagacaagctgtacacggattttcaaactgtacttgaagggcgcaaagagctgact
ctgaaccgggaacgcgccgagtatgtgtttaacaacctctacattcctgatgcgcaagag
tatcgccaccatattattcgcgcagacaccttccatcttagtgccgtgaactggtcaaac
atcatgatgctgggcgcaatcggcctggtgttctggatggcgaacagcctcggttgggct
gataccaacgttgccgcgacctattcgttgacgcttttattcctgcgtacgccgctgctt
tcggcggttggcgcattgccgacgctgctgacggcgcaggtggcgtttaacaagctgaac
aaattcgcgctcgcgcctttcaaagcagagtttccgcgcccgcaggcgtttcccaactgg
caaacgctggagctgcgtaacgtgacgtttgcttatcaggataacgcgttttccgttggt
ccgattaatctcaccatcaaacgtggcgagctgctgtttctgattggcggcaacggtagc
ggaaaatcgacgctggcgatgttgttgacgggcttgtatcagccacaaagcggcgaaatc
ttgctggatggcaaacctgtcagcggcgaacaaccggaagattatcgcaaactgttttcg
gcagtgtttaccgatgtctggctgtttgatcaactgctggggccggagggtaaacccgct
aacccgcaactggttgagaagtggctggcgcagctgaaaatggctcataagcttgagtta
agcaacgggcgtattgttaacctgaagttatcaaaagggcagaaaaaacgcgtggcgctg
ttgctggcgctggcagaagaacgcgatattatcctgctggatgaatgggcggcggatcag
gatccacacttccgtcgtgagttttatcaggtgttgctgccgctgatgcaggagatgggt
aaaactattttcgctatcagtcatgatgatcattactttatccacgccgaccgcctgctg
gaaatgcgcaatgggcaacttagcgagctgacgggcgaagagcgcgatgccgcttcgcgt
gatgccgttgcccggacggcataa
              
                            

Download fasta file
RegulonDB